Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
783 
Type of strain Transgenic. 
Strain name STOCK-Tg(Prp-Prpn/Prpd)03106Ngs 
Internal Code fusion 
Submitter YOSHIKAWA DAISUKE 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Departmennto of Molecular Microbiology and Immunology  
Organization code Ngs 
Developer Daisuke Yoshikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Prnp/Prnd 
Gene name prion protein/prion protein dublet 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer SHa-forward  gcgtgctggacaatgacgtg 
fusion-reverse  gccaatagttagccgcgtag 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown