Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
757 
Type of strain Transgenic. 
Strain name C57BL/6Slc-Tg(CAG-Per2)MX03-1CCB 
Internal Code MX03-1 
Submitter Koyomi Miyazaki 
Submitter affiliation or code AIST, Institute of Biological Resource and Function, Clock Cell Biology 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Japan Slc 
Organization code
Developer  
Year introduced October 2001  
Introduced 
Generation
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Per2 
Gene name period homolog 2 (Drosophila) 
Allele symbol  
Allele name  
MGI MGI:1195265 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM OMIM ID: 603426
Human Gene Symbol: PER2

 
 Primer 1
  PCR Primer rPer2-MX5-F1  ACTCAGGCTATGAAGCTCCTAGA 
rPer2-MX5-R1  GTGCAGAGGGACAGCTAGAC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Physiology 
  OMIM OMIM ID: 603426
Human Gene Symbol: PER2
Allelic Variant Name :
ADVANCED SLEEP-PHASE SYNDROME, FAMILIAL