Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
744 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(FMS-NS1)4Tusm 
Internal Code C57BL/6-Tg(fB19NS1m)4Tusm, F4m 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Tohoku University 
Organization code Tusm 
Developer Naruhiko Takasawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
NS1 
Gene name himun parvovirus B19 NS1(K334E) 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection
Other 
OMIM
 
 Primer 1
  PCR Primer Im-1  CGCCTGGAACACTGAAACCC 
Im-2  AGCCTGCACCTGAGGAGTGA 
 

 Reference information
 reference information 1
  Author
Naruhiko Takasawa, Yasuhiko Munakata, Keiko Kumura Ishii, Yuichi Takahashi, Minako Takahashi, Yi Fu, Tomonori Ishii, Hiroshi Fujii, Takako Saito, Hiroshi Takano, Tetsuo Noda, Misao Suzuki, Masato Nose, Suzan Zolla-Patzner, and Takeshi Sasaki 
Title Human Parvovirus B19 Transgenic Mice Become Susceptible to Polyarthritis 
Journal The Journal of Immunology 
Volume 173 
Page 4675-4683 
Year 2004 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Immunology