Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
733 
Type of strain Gene trap. 
Strain name C57BL/6J-Cdc42se2Gt(pU-22)79Imeg 
Internal Code Ayu22-79 
Submitter Masatake ARAKI 
Submitter affiliation or code Gene Technology Center, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cdc42se2 
Gene name CDC42 small effector 2 
Allele symbol  
Allele name  
MGI MGI:1919979 
Chromosome 11  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0005737 cytoplasm IEA
GO:0005856 cytoskeleton IEA
GO:0006909 phagocytosis IEA
GO:0016020 membrane IEA
GO:0008360 regulation of cell shape IEA
GO:0005886 plasma membrane IEA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0005737 cytoplasm IEA
GO:0005856 cytoskeleton IEA
GO:0006909 phagocytosis IEA
GO:0016020 membrane IEA
GO:0008360 regulation of cell shape IEA
GO:0005886 plasma membrane IEA
 
 Primer 1
  PCR Primer Neo-F  AGAGGCTATTCGGCTATGAC 
Neo-R  CACCATGATATTCGGCAAGC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
22-79