Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
732 
Type of strain Gene trap. 
Strain name C57BL/6-Jarid2Gt(pU-22)33Imeg 
Internal Code Ayu22A-33 
Submitter Masatake ARAKI 
Submitter affiliation or code Gene Technology Center, Kumamoto University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Jarid2 
Gene name jumonji, AT rich interactive domain 2 
Allele symbol  
Allele name  
MGI MGI:104813 
Chromosome 13 (27.0) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0006350 transcription IEA
GO:0008285 negative regulation of cell proliferation IMP
GO:0045449 regulation of transcription IEA
GO:0007275 multicellular organismal development IEA
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IGI
GO:0045892 negative regulation of transcription, DNA-dependent IDA
GO:0001889 liver development IMP
GO:0048536 spleen development IMP
GO:0048538 thymus development IMP
GO:0042127 regulation of cell proliferation IMP
more... (Total Hit Count: 15)
OMIM OMIM ID: 601594
Human Gene Symbol: JARID2

GO
GO ID GO Term GO Evidence Code
GO:0006350 transcription IEA
GO:0008285 negative regulation of cell proliferation IMP
GO:0045449 regulation of transcription IEA
GO:0007275 multicellular organismal development IEA
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IGI
GO:0045892 negative regulation of transcription, DNA-dependent IDA
GO:0001889 liver development IMP
GO:0048536 spleen development IMP
GO:0048538 thymus development IMP
GO:0042127 regulation of cell proliferation IMP
more... (Total Hit Count: 15)
 
 Primer 1
  PCR Primer Neo-F  AGAGGCTATTCGGCTATGAC 
Neo-R  CACCATGATATTCGGCAAGC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 601594
Human Gene Symbol: JARID2

 
 Related imformation
  EGTC
22-33