Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
704 
Type of strain Transgenic. 
Strain name C57BL/6J-Tg(Ela1-Cre) 
Internal Code Rat elastase I enhancer/promoter -Cre 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Laboratory of Developmental Genetics, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Division of Developmental Genetics, IMEG, Kumamoto Univ. 
Organization code Imeg 
Developer Hashimoto Daisuke 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cre 
Gene name Cre 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Cre-3  AATGCTTCTGTCCGTTTGCC 
Cre-4  CTACACCAGAGACGGAAATC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development