Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
703 
Type of strain Transgenic. 
Strain name C57BL/6J-Tg(CAG-SAG1) 1Nrp 
Internal Code C57BL/6J-Tg(cag-p30) 1Nrp, P30tg 
Submitter Hiroshi Suzuki 
Submitter affiliation or code National Research Center for Protozoan Disease 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization National Research Center for Protozoan Disease 
Organization code Nrp 
Developer Yutaka Toyoda 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
SAG-1 
Gene name major surface antigen P30 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer SAG-1(P30)F primer  CACTCTCAAGTGCCCTAAAA 
SAG-1(P30)Re primer  GAACTTTGACTCCATCTTTCC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Immunology