Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
688 
Type of strain Gene trap. 
Strain name C57BL/6J-Asp4Gt(Ayu22)74Imeg 
Internal Code Ayu22-74 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Asp4 
Gene name adipocyte-specific protein 4 
Allele symbol  
Allele name  
MGI MGI:1914413 
Chromosome 11 (106,015,000-106,033,000 ) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0006983 ER overload response IMP
GO:0005509 calcium ion binding IDA
GO:0055074 calcium ion homeostasis IMP
GO:0009790 embryonic development IMP
GO:0005783 endoplasmic reticulum IDA
GO:0005792 microsome IDA
GO:0009791 post-embryonic development IMP
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0006983 ER overload response IMP
GO:0005509 calcium ion binding IDA
GO:0055074 calcium ion homeostasis IMP
GO:0009790 embryonic development IMP
GO:0005783 endoplasmic reticulum IDA
GO:0005792 microsome IDA
GO:0009791 post-embryonic development IMP
 
 Primer 1
  PCR Primer Neo-F  AGAGGCTATTCGGCTATGAC 
Neo-R  CACCATGATATTCGGCAAGC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
22-74