Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
622 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(NPY-Cre)Rck 
Internal Code NPY-Cre 
Submitter Tamamaki Nobuaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Jeffrey Friedman 
Organization code Rck 
Developer Rockefeller University 
Year introduced June 2004  
Introduced 
Generation
 
Remarks Need MTA with Dr. Jeffrey Friedman 
 
 Gene information
 Gene information 1
  Gene symbol
Cre 
Gene name Cre recombinase 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown    Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer P312 Creup. seq  GCATCAAGCTTGATGTCCAATTTACTGACCGT 
P527 Cre-a  CCGCATAACCAGTGAAACAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Development, Anatomy, Physiology