Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
556 
Type of strain Targeted mutant. 
Strain name ICR.129-Il6sttm1 
Internal Code gp130tm
ICR.129-Il6sttm1 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Osaka University 
Organization code Unknown 
Developer Kanji Yoshida 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Il6st (synonim:gp130) 
Gene name interleukin 6 signal transducer 
Allele symbol Il6sttm1 
Allele name targeted mutation 1 
MGI  
Chromosome 13 (67.0) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM OMIM ID: 600694
Human Gene Symbol: IL6ST

 
 Primer 1
  PCR Primer p-370  CCCCAACCTTAACATTATGGAGGTAG 
P-neo  CCGACTGCATCTGCGTGTTCGAATT 
 

 Reference information
 reference information 1
  Author
KANJI YOSHIDA, TETSUYA TAGA, MIKIYOSHI SAITO, SACHIKO SUEMATSU, ATSUSHI KUMANOGOH, TAKASHI TANAKA, HIROSHI FUJIWARA, MORITOSHI HIRATA, TAMOTSU YAMAGAMI, TATSUTOSHI NAKAHATA, TOMOKO HIRABAYASHI, YOSHIHIRO YONEDA, KAZUHIKO TANAKA, WEI-ZHONG WANG, CHISATO MO 
Title Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders (myocardial development/hematopoiesis) 
Journal Medical Science 
Volume 93 
Page 407-411 
Year 1996 
PMID 12093905  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Development 
  OMIM OMIM ID: 600694
Human Gene Symbol: IL6ST