Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
508 
Type of strain Targeted mutant. 
Strain name B6;129S4-Frap1tm2 
Internal Code mTOR conditional knockout mouse
B6;129S4-Frap1tm2 
Submitter Shinya Yamanaka 
Submitter affiliation or code Center for iPS Cell Research and Application (CiRA), Kyoto University 
Stock Type  
Material Transfer Conditions Other conditions. 
(1) Recipient and Recipient scientist shall receive the prior written approval from Provider, if Recipient scientist uses the material with anyone else outside of the Recipient scientist's laboratory to carry out the Research. (2) The material shall be used only by Recipient scientist and others working under Recipient scientist's direct supervision at Recipient scientist's laboratory, and shall not be used by, as well as shall not be distributed and assigned to anyone else either at the Recipient organization or outside the organization. (3) At the time of publication of the result from the Research using the material, whether in print or in electronic form, Recipient scientist shall provide a copy of each publication to Provider. (4) Recipient and Recipient scientist acknowledge that this Agreement is not the agreement to license the intellectual property rights relating the material owned by Provider to Recipient and Recipient scientist. Recipient and Recipient scientist also acknowledge that no express or implied licenses or other rights are provided to Recipient and Recipient scientist from Provider to use the material, or any related patents of Provider for commercial purposes. (5) Recipient scientist shall cite the paper specified below in any publication of the result from the Research. Murakami, M. et al. mTOR is essential for growth and proliferation in early mouse embryos and embryonic stem cells. Mol Cell Biol. 2004 Aug;24(15):6710-8. 
Production method In-house breading.
 
Origin
(In-house)
Organization Center for iPS Cell Research and Application (CiRA), Kyoto University 
Organization code  
Developer Shinya Yamanaka 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Frap1 
Gene name FK506 binding protein 12-rapamycin associated protein 1 
Allele symbol Frap1tm2 
Allele name targeted mutation 2 
MGI  
Chromosome 4 (71.0) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM OMIM ID: 601231
Human Gene Symbol: FRAP1

 
 Primer 1
  PCR Primer β geo-screening 1  AATGGGCTGACCGCTTCCTCGTGCTT 
c-con TOR tail L33303  TGGAGATCCTTGGCACACCTGCTCAT 
 

 Reference information
 reference information 1
  Author
Mirei Murakami, Tomoko Ichisaka, Mitsuyo Maeda, Noriko Oshiro, Kenta Hara, Frank Edenhofer, Hiroshi Kiyama, Kazuyoshi Yonezawa, and Shinya Yamanaka 
Title mTOR Is Essential for Growth and Proliferation in Early Mouse Embryos and Embryonic Stem Cells 
Journal MOLECULAR AND CELLULAR BIOLOGY 
Volume 24 
Page 6710-6718 
Year 2004 
PMID 15254238  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 601231
Human Gene Symbol: FRAP1