Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
Type of strain Transgenic. 
Strain name B6;C-Tg(Mt1-RET)242Num 
Internal Code B6;C-Tg(Mt1-RFP/RET)242Num 
Submitter Kato Masashi 
Submitter affiliation or code Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization Nagoya University Graduate School of Medicine 
Organization code Num 
Developer Masashi Kato 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name Ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease)(Human) 
Allele symbol  
Allele name  
MGI MGI:97902 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
GO ID GO Term GO Evidence Code
GO:0001755 neural crest cell migration IMP
GO:0016740 transferase activity IEA
GO:0007156 homophilic cell adhesion IEA
GO:0007399 nervous system development IMP
GO:0006468 protein amino acid phosphorylation IEA
GO:0000166 nucleotide binding IEA
GO:0004713 protein tyrosine kinase activity IEA
GO:0005515 protein binding IPI
GO:0005509 calcium ion binding IEA
more... (Total Hit Count: 23)
OMIM OMIM ID: 164761
Human Gene Symbol: RET

GO ID GO Term GO Evidence Code
GO:0001755 neural crest cell migration IMP
GO:0016740 transferase activity IEA
GO:0007156 homophilic cell adhesion IEA
GO:0007399 nervous system development IMP
GO:0006468 protein amino acid phosphorylation IEA
GO:0000166 nucleotide binding IEA
GO:0004713 protein tyrosine kinase activity IEA
GO:0005515 protein binding IPI
GO:0005509 calcium ion binding IEA
more... (Total Hit Count: 23)
 Primer 1
  PCR Primer primerA  5'(aaaatgcagtcagatatgga)3' 
primerB  5'(actcggggaggcgttc)3' 

 Reference information
 reference information 1
Takashi Iwamoto, Masahide Takahashi, Masafumi Ito, Kiyohiro Hamatani, Masaharu Ohbayashi, Worawidh Wajjwalku, Ken-ichi Isobe and Izumi Nakashima 
Title Aberrant melanogenesis and melanocytic tumour development in transgenic mice that carry a metallothionein/ret fusion gene 
Journal The EMBO Journal 
Volume 10 
Page 3167-3175 
Year 1991 
PMID 1915289  
 reference information 2
Masashi Kato Nakajima Izumi Masahide Takahashi 
Title Mouse models for Hirschsprung's disease and Malignant melanoma 
Journal Pathology and clinical 
Volume 16 
Page 1149-1152 
Year 1998 
 Disease , Applicable field information
  Disease name,
Applicable field
Dermatology, cancer 
  OMIM OMIM ID: 164761
Human Gene Symbol: RET
Allelic Variant Name :