Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
379 
Type of strain Targeted mutant. 
Strain name STS.B6CB-Trp53tm1Sia 
Internal Code STS/A-p53+/KO
STS.B6CB-Trp53tm1Sia 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions No condition. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Shiro Aizawa 
Organization code  
Developer National Institute of Radiological Sciences 
Year introduced September 2001  
Introduced 
Generation
N17 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Trp53 
Gene name Transformation related protein 53 
Allele symbol Trp53tm1Sia 
Allele name Trp53, targeted mutation 1, Shinichi Aizawa 
MGI MGI:98834 
Chromosome 11  
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
GO
GO ID GO Term GO Evidence Code
GO:0042149 cellular response to glucose starvation ISO
GO:0002347 response to tumor cell IEA
GO:0033077 T cell differentiation in the thymus IGI
GO:0002309 T cell proliferation during immune response IGI
GO:0051276 chromosome organization IGI
GO:0034644 cellular response to UV IGI
GO:0048147 negative regulation of fibroblast proliferation IMP, IDA
GO:0010165 response to X-ray IDA
GO:0043066 negative regulation of apoptosis IMP
GO:0031571 G1/S DNA damage checkpoint IMP
more... (Total Hit Count: 90)
OMIM OMIM ID: 191170
Human Gene Symbol: TP53

GO
GO ID GO Term GO Evidence Code
GO:0042149 cellular response to glucose starvation ISO
GO:0002347 response to tumor cell IEA
GO:0033077 T cell differentiation in the thymus IGI
GO:0002309 T cell proliferation during immune response IGI
GO:0051276 chromosome organization IGI
GO:0034644 cellular response to UV IGI
GO:0048147 negative regulation of fibroblast proliferation IMP, IDA
GO:0010165 response to X-ray IDA
GO:0043066 negative regulation of apoptosis IMP
GO:0031571 G1/S DNA damage checkpoint IMP
more... (Total Hit Count: 90)
 
 Primer 1
  PCR Primer primerA  5'(aattgacaagttatgcatccatacagtaaca)3' 
primerB  5'(actcctcaacatcctggggcagcaacagat)3' 
 

 Reference information
 reference information 1
  Author
M Okumoto, R Nishikawa, S Imai and J Hilgers 
Title Genetic analysis of resistance to radiation lymphomagenesis with recombinant inbred strains of mice 
Journal Cancer Research 
Volume 50 
Page 3848-3850 
Year 1990 
PMID 2354437  
 
 reference information 2
  Author
Okumoto M, Nishikawa R, Imai S, Hilgers J. 
Title Resistance of STS/A mice to lymphoma induction by X-irradiation. 
Journal J Radiat Res (Tokyo) 
Volume 30 
Page 135-139 
Year 1989 
PMID 2769623  
 
 Disease , Applicable field information
  Disease name,
Applicable field
cancer 
  OMIM OMIM ID: 191170
Human Gene Symbol: TP53
Allelic Variant Name :
LI-FRAUMENI SYNDROME 1
NON-HODGKIN LYMPHOMA
BREAST CANCER, SOMATIC
LI-FRAUMENI SYNDROME
ADRENOCORTICAL CARCINOMA, PEDIATRIC
CHOROID PLEXUS PAPILLOMA
CODON 72 POLYMORPHISM
PANCREATIC CANCER, SOMATIC
REMOVED FROM DATABASE
EPENDYMOMA, INTRACRANIAL
OSTEOSARCOMA
MOVED TO 191170.0018
HEPATOCELLULAR CARCINOMA, SOMATIC
HEPATOBLASTOMA
COLORECTAL CANCER
NASOPHARYNGEAL CARCINOMA, SOMATIC