Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
369 
Type of strain Targeted mutant. 
Strain name ICR;129-Hprttm1 
Internal Code HPRT KO
ICR;129-Hprttm1 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions No condition. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Hitoshi Niwa 
Organization code  
Developer Department of Nutrition and Physiological chemistry, Osaka Unv. Med. Sch. 
Year introduced March 1999  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Hprt 
Gene name Hypoxanthine guanine phosphoribosyl transferase 
Allele symbol Hprttm1 
Allele name Hprt, targetedd mutation 1 
MGI MGI:96217 
Chromosome X (XA4, XA5 band , 16.03-17.97 cM) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Other 
OMIM
 
 Primer 1
  PCR Primer primerA  5'(gcagattagcgatgatgaacc)3' 
primerB  5'(cctgtccataatcagtccatga)3' 
 

 Reference information
 reference information 1
  Author
Martin Hooper, Kate Hardy, Alan Handyside, Susan Hunter & Marilyn Monk 
Title HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells 
Journal NATURE 
Volume 326 
Page 292-295 
Year 1987 
PMID 3821905  
 
 reference information 2
  Author
Simon Thompson, Alan R. Clarke, Angela M. Pow, Martin L. Hooper, and David W. Melton 
Title Germ Line Transmission and Expression of a Corrected HPRT Gene Produced by Gene Targeting in Embryonic Stem Cells 
Journal Cell 
Volume 56 
Page 313-321 
Year 1989 
PMID 2912572  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development