Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2691 
Type of strain Targeted mutant. 
Strain name 129S6/SvEv-Vps13atm1asan 
Internal Code 129S6/SvEv-ChAc 
Submitter Sano Akira  
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method
 
Origin
(In-house)
Organization Kagoshima University Graduate School of Medical and Dental Sciences 
Organization code  
Developer Akira Sano 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
vps13a 
Gene name Vacuolar Protein Sorting 13 Homolog A 
Allele symbol vps13atm1asan 
Allele name vacuolar protein sorting 13A; targeted mutation 1, Akira Sano 
MGI MGI:2444304 
Chromosome 19 (11.71) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer wild-F  ACAATGCCAAGAGAATAGAGTT 
Neo-F  TTGTCAAGACCGACCTGTCC 
intR-S  GGGCCCCTAATGAAGAGAAA 
 

 Reference information
 reference information 1
  Author
Tomemori Y, Ichiba M, Kusumoto A, Mizuno E, Sato D, Muroya S, Nakamura M, Kawaguchi H, Yoshida H, Ueno S, Nakao K, Nakamura K, Aiba A, Katsuki M, Sano A. 
Title A gene-targeted mouse model for chorea-acanthocytosis. 
Journal  
Volume  
Page  
Year  
PMID  
 
 reference information 2
  Author
Sakimoto H, Nakamura M, Nagata O, Yokoyama I, Sano A 
Title Phenotypic abnormalities in a chorea-acanthocytosis mouse model are modulated by strain background. 
Journal  
Volume  
Page  
Year  
PMID