Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2620 
Type of strain Targeted mutant. 
Strain name B6D2-Ccdc63em1Osb 
Internal Code Ccdc63 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ccdc63 
Gene name coiled-coil domain containing 63 
Allele symbol Ccdc63em1Osb 
Allele name coiled-coil domain containing 63, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:3607777 
Chromosome 5 (62.17) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer Ccdc63Fw  GGGAATTCCTACCCTACGACAGACAGGC 
Ccdc63Rv  GGGGATCCGCTCACTGGATATCTTCCCG 
 

 Reference information
 reference information 1
  Author
Young SA, Miyata H, Satouh Y, Kato H, Nozawa K, Isotani A, Aitken RJ, Baker MA, Ikawa M. 
Title CRISPR/Cas9-Mediated Rapid Generation of Multiple Mouse Lines Identified Ccdc63 as Essential for Spermiogenesis. 
Journal Int J Mol Sci. 
Volume 16 
Page 24732-50 
Year 2015 
PMID