Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2618 
Type of strain Targeted mutant. 
Strain name B6D2-Ppp3r2em1Osb 
Internal Code Ppp3r2 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ppp3r2 
Gene name protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II) 
Allele symbol Ppp3r2em1Osb 
Allele name protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II), endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:107171 
Chromosome 4 (26.75) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer Ppp3r2Fw  AAGAATTCCCAGGCCAACGGTAGCACGG 
Ppp3r2Rv  AAGGATCCAAACTCACACAAACACGACC 
 

 Reference information
 reference information 1
  Author
Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. 
Title Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. 
Journal Science 
Volume 350(6259) 
Page 442-5 
Year 2015 
PMID