Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2616 
Type of strain Transgenic. 
Strain name B6D2-Tg(Clgn-Ppp3cc,FLAG)Osb/1 
Internal Code Ppp3cc-FLAG Tg #1 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ppp3cc 
Gene name Ppp3cc 
Allele symbol Tg(Clgn-Ppp3cc,FLAG)Osb/1 
Allele name transgene insertion, Research Institute for Microbial Diseases, Osaka University 
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer Ppp3ccflagFw  CCCGAATTCGGAGCCGGGAGGAGACCATGT 
Ppp3ccflagRv  GAATTTATCGTCGTCATCCTTATAATC 
 

 Reference information
 reference information 1
  Author
Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. 
Title Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. 
Journal Science 
Volume 350(6259) 
Page 442-5 
Year 2015 
PMID