Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2613 
Type of strain Targeted mutant. 
Strain name B6.129S2-Mir200btm1.1Osb Mir429T30C 
Internal Code miR-DKO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Mir429 
Gene name microRNA 429 
Allele symbol Mir429T31C 
Allele name  
MGI MGI:3619402 
Chromosome 4 (87.95) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Gene information 2
  Gene symbol
Mir200b 
Gene name microRNA 200b 
Allele symbol Mir200btm1.1Osb  
Allele name microRNA 200b, targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:2676875 
Chromosome 4 (87.96) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer pr-3  GCACTTGACTGTCCTAATTCCCAGGGC 
pr-4  GCCCATGGAATCTAGTCATCTTCAACTCCC 
 

 Reference information
 reference information 1
  Author
Hasuwa H, Ueda J, Ikawa M, Okabe M. 
Title miR-200b and miR-429 function in mouse ovulation and are essential for female fertility. 
Journal Science 
Volume 341(6141) 
Page 71-3 
Year 2013 
PMID