Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2537 
Type of strain Transgenic. 
Strain name B6.Cg-Tg(CAG-FLPo)1Osb 
Internal Code C57BL/6(CAG-FLPo)#1 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
FLPo 
Gene name FLPo 
Allele symbol Tg(CAG-FLPo)1Osb 
Allele name transgene insertion 1, Research Institute for Microbial Diseases, Osaka University 
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer 750  GCAACGTGCTGGTTGTTGTGCTGTCTCATC 
5867  TCAGATCCGCCTGTTGATGTAGCTG 
 

 Reference information
 reference information 1
  Author
Yamazaki D, Miyata H, Funato Y, Fujihara Y, Ikawa M, Miki H. 
Title The Mg2+ transporter CNNM4 regulates sperm Ca2+ homeostasis and is essential for reproduction. 
Journal J Cell Sci.  
Volume 129(9) 
Page 1940-9 
Year 2016 
PMID