Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2532 
Type of strain Targeted mutant. 
Strain name STOCK-Tcte1em1(Tcte1-Flag)Osb 
Internal Code Tcte1-FLAG KI 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Tcte1 
Gene name t-complex-associated testis expressed 1 
Allele symbol Tcte1em1(Tcte1-Flag)Osb 
Allele name t-complex-associated testis expressed 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:98640 
Chromosome 17 (22.54) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer F03  CTAGACCGACTATTCTCAGG 
R01  TGTACAAGCAGACAACGTCAGG 
 

 Reference information
 reference information 1
  Author
Castaneda JM, Hua R, Miyata H, Oji A, Guo Y, Cheng Y, Zhou T, Guo X, Cui Y, Shen B, Wang Z, Hu Z, Zhou Z, Sha J, Prunskaite-Hyyrylainen R, Yu Z, Ramirez-Solis R, Ikawa M, Matzuk MM, Liu M 
Title TCTE1 is a conserved component of the dynein regulatory complex and is required for motility and metabolism in mouse spermatozoa 
Journal Proc Natl Acad Sci 
Volume 114 (27) 
Page 5370-5378 
Year 2017 
PMID