Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2518 
Type of strain Targeted mutant. 
Strain name B6D2-C1qtnf4em1Osb 
Internal Code C1qtnf4 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
C1qtnf4 
Gene name C1q and tumor necrosis factor related protein 4 
Allele symbol C1qtnf4em1Osb 
Allele name C1q and tumor necrosis factor related protein 4, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:1914695 
Chromosome 2 (50.43) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer C1qtnf4 fwd  ATGGGTCAAGAGTAAGGCTAGGAAGAGATG 
C1qtnf4 rev  AGCGGAACCGCCCGGTGGCTGCGTCGAAGT 
 

 Reference information
 reference information 1
  Author
Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.  
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. 
Journal Proc Natl Acad Sci U S A. 
Volume 113(28) 
Page 7704-10 
Year 2016 
PMID