Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2489 
Type of strain Transgenic. 
Strain name B6D2-Tg(Stra8-Cre)1Osb 
Internal Code Stra8-cre 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cre 
Gene name Cre 
Allele symbol Tg(Stra8-Cre)1Osb 
Allele name transgene insertion 1, Research Institute for Microbial Diseases, Osaka University 
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer 259  TTCCAGGGCGCGAGTTGATAG 
5224  CTCCAAGGGGGTAAGGTGTAGC 
 

 Reference information
 reference information 1
  Author
Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4. 
Title Calreticulin is required for development of the cumulus oocyte complex and female fertility. 
Journal Sci Rep. 
Volume
Page 14254 
Year 2015 
PMID