Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2488 
Type of strain Transgenic. 
Strain name B6D2-Tg(CAG-flpo)2Osb 
Internal Code CAG-FLPo #2 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
FLPo 
Gene name FLPo 
Allele symbol Tg(CAG-FLPo)2Osb 
Allele name transgene insertion 2, Research Institute for Microbial Diseases, Osaka University 
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer 750  GCAACGTGCTGGTTGTTGTGCTGTCTCATC 
5867  TCAGATCCGCCTGTTGATGTAGCTG 
 

 Reference information
 reference information 1
  Author
Yamazaki D, Miyata H, Funato Y, Fujihara Y, Ikawa M, Miki H. 
Title The Mg2+ transporter CNNM4 regulates sperm Ca2+ homeostasis and is essential for reproduction. 
Journal J Cell Sci.  
Volume 129(9) 
Page 1940-9 
Year 2016 
PMID