Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
249 
Type of strain Transgenic. 
Strain name B6;BALB-Tg(0.6hTTRMet30)14Imeg 
Internal Code
 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute for Molecular Embryology and Genetics 
Organization code IMEG 
Developer Ken-ichi Yamamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ttr 
Gene name transthyretin Val 30 Met (Human) 
Allele symbol  
Allele name  
MGI MGI:98865 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method  
GO
GO ID GO Term GO Evidence Code
GO:0005179 hormone activity IEA
GO:0005576 extracellular region IEA
GO:0006810 transport IEA
OMIM OMIM ID: 176300
Human Gene Symbol: TTR

GO
GO ID GO Term GO Evidence Code
GO:0005179 hormone activity IEA
GO:0005576 extracellular region IEA
GO:0006810 transport IEA
 
 Primer 1
  PCR Primer primerA  5'(TCTCACGTGTCTTCTCTACA)3' 
primerB  3'(AGCCTCTCTCTACCAAGTGA)5' 
 

 Reference information
 reference information 1
  Author
Hiromitsu Noguchi, Tadashi Kaname, Tomohisa Sekimoto, Kei Senba, Yasushi Nagata, Masatake Araki, Makoto Abe, Naomi Nakagata, Tomomichi Ono, Ken-ichi Yamamura and Kimi Araki 
Title Naso-maxillary deformity due to frontonasal expression of human transthyretin gene in transgenic mice 
Journal Genes to Cells 
Volume
Page 1087-1098 
Year 2002 
PMID 12354101  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 176300
Human Gene Symbol: TTR
Allelic Variant Name :
AMYLOIDOSIS, OCULOLEPTOMENINGEAL
TRANSTHYRETIN ACIDIC ASN-90 VARIANT
AMYLOID POLYNEUROPATHY, JEWISH TYPE
AMYLOIDOSIS, LEPTOMENINGEAL
HYPERTHYROXINEMIA, FAMILIAL DYSPREALBUMINEMIC EUTHYROID
AMYLOID POLYNEUROPATHY
AMYLOIDOSIS, SENILE
AMYLOIDOSIS, SYSTEMIC, NEUROPATHIC, AND LEPTOMENINGEAL
AMYLOID POLYNEUROPATHY, RUKAVINA OR INDIANA TYPE
AMYLOIDOSIS, CARDIAC OR DENMARK TYPE
AMYLOID POLYNEUROPATHY, MAHLOUDJI OR MARYLAND TYPE
AMYLOID POLYNEUROPATHY, ANDRADE OR PORTUGUESE TYPE
AMYLOID POLYNEUROPATHY, APPALACHIAN TYPE
TRANSTHYRETIN POLYMORPHISM
CARPAL TUNNEL SYNDROME, FAMILIAL
AMYLOIDOSIS, FAMILIAL
AMYLOID CARDIOMYOPATHY
PREALBUMIN CHICAGO
AMYLOID POLYNEUROPATHY, GERMAN-AMERICAN TYPE
TRANSTHYRETIN SER-6 POLYMORPHISM