Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2469 
Type of strain Targeted mutant. 
Strain name B6D2-Dppa1em1Osb 
Internal Code Dppa1 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
developmental pluripotency associated 1 
Gene name Dppa1 
Allele symbol Dppa1em1Osb 
Allele name developmental pluripotency associated 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:2157522 
Chromosome 11 (28.02) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer Primer-1  GTGGCTACTGAGCGGAAAGA 
Primer-2  TCCAATGGAATATGGGCCAGT 
 

 Reference information
 reference information 1
  Author
Oji A, Noda T, Fujihara Y, Miyata H, Kim YJ, Muto M, Nozawa K, Matsumura T, Isotani A, Ikawa M. 
Title CRISPR/Cas9 mediated genome editing in ES cells and its application for chimeric analysis in mice. 
Journal Scientific reports. 
Volume
Page 31666  
Year 2016 
PMID