Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2459 
Type of strain Targeted mutant. 
Strain name B6D2-Izumo1em1(S346Stop)Osb 
Internal Code Izumo1 cyt 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Izumo1 
Gene name izumo sperm-egg fusion 1 
Allele symbol Izumo1em1(S346Stop)Osb 
Allele name izumo sperm-egg fusion 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University  
MGI MGI:1920706 
Chromosome 7 (29.39) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer genotyping Fw  GGATGGATGGAAAGGAAACG 
genotyping Rv  GGAGCCAGAAGTCAGAACCA 
 

 Reference information
 reference information 1
  Author
Young SA, Miyata H, Satouh Y, Muto M, Larsen MR, Aitken RJ, Baker MA, Ikawa M 
Title CRISPR/Cas9-mediated mutation revealed cytoplasmic tail is dispensable for IZUMO1 function and male fertility 
Journal Reproduction 
Volume 152 (6) 
Page 665-672 
Year 2016 
PMID