Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Reference 
 Strain information
Type of strain Targeted mutant. 
Strain name B6D2-BC051628em1Osb 
Internal Code BC051628 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions Other conditions. 
Production method
Organization code  
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name fibronectin type III domain containing 11 
Allele symbol BC051628em1Osb 
Allele name BC051628, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University  
MGI MGI:3051572 
Chromosome 2 (103.63) 
Gene classification Targeted or trapped gene(knockout etc.) 
 Primer 1
  PCR Primer GeneD_check_F  catcgccacaaaatactattggcc 

 Reference information
 reference information 1
Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.  
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. 
Journal Proc Natl Acad Sci U S A. 
Volume 113(28) 
Page 7704-10 
Year 2016