Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
243 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(0.6hTTRMet30)14Imeg 
Internal Code
Nax-normal 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Laboratory of Developmental Genetics, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics, Kumamoto Univ. 
Organization code  
Developer Ken-ichi Yamamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ttr 
Gene name Transthyretin Val30Met(Human) 
Allele symbol  
Allele name  
MGI MGI:98865 
Chromosome 13  
Gene classification Gene to express(transgenic) 
Method  
GO
GO ID GO Term GO Evidence Code
GO:0005179 hormone activity IEA
GO:0005576 extracellular region IEA
GO:0006810 transport IEA
OMIM OMIM ID: 176300
Human Gene Symbol: TTR

GO
GO ID GO Term GO Evidence Code
GO:0005179 hormone activity IEA
GO:0005576 extracellular region IEA
GO:0006810 transport IEA
 
 Primer 1
  PCR Primer primerA  5'(TCTCACGTGTCTTCTCTACA)3' 
primerB  3'(AGCCTCTCTCTACCAAGTGA)5' 
 

 Reference information
 reference information 1
  Author
Shoji Wakasugi, Tomohisa Iwanaga, Takeaki Inomoto, Toshimoto Tengan, Shuichiro Maeda, Masahiro Uehira, Kimi Araki, Junichi Miyazaki, Kazuhiro Eto, Kazunori Shimada, and Ken-ichi Yamamura 
Title An Autosomal Dominant Mutation of Facial Development in a Transgenic Mouse 
Journal Developmental Genetics 
Volume
Page 203-212 
Year 1988 
PMID 3409558  
 
 reference information 2
  Author
Hiromitsu Noguchi, Tadashi Kaname, Tomohisa Sekimoto, Kei Senba, Yasushi Nagata, Masatake Araki, Makoto Abe, Naomi Nakagata, Tomomichi Ono, Ken-ichi Yamamura and Kimi Araki 
Title Naso-maxillary deformity due to frontonasal expression of human transthyretin gene in transgenic mice 
Journal Genes to Cells 
Volume
Page 1087-1098 
Year 2002 
PMID 12354101  
 
 Disease , Applicable field information
  OMIM OMIM ID: 176300
Human Gene Symbol: TTR
Allelic Variant Name :
TRANSTHYRETIN ACIDIC ASN-90 VARIANT
AMYLOID POLYNEUROPATHY, ANDRADE OR PORTUGUESE TYPE
AMYLOID POLYNEUROPATHY, APPALACHIAN TYPE
AMYLOIDOSIS, OCULOLEPTOMENINGEAL
AMYLOIDOSIS, LEPTOMENINGEAL
AMYLOID POLYNEUROPATHY
AMYLOIDOSIS, SENILE
TRANSTHYRETIN POLYMORPHISM
AMYLOIDOSIS, CARDIAC OR DENMARK TYPE
AMYLOID POLYNEUROPATHY, GERMAN-AMERICAN TYPE
AMYLOID POLYNEUROPATHY, MAHLOUDJI OR MARYLAND TYPE
AMYLOID POLYNEUROPATHY, RUKAVINA OR INDIANA TYPE
HYPERTHYROXINEMIA, FAMILIAL DYSPREALBUMINEMIC EUTHYROID
PREALBUMIN CHICAGO
AMYLOIDOSIS, FAMILIAL
CARPAL TUNNEL SYNDROME, FAMILIAL
TRANSTHYRETIN SER-6 POLYMORPHISM
AMYLOIDOSIS, SYSTEMIC, NEUROPATHIC, AND LEPTOMENINGEAL
AMYLOID CARDIOMYOPATHY
AMYLOID POLYNEUROPATHY, JEWISH TYPE