Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2416 
Type of strain Transgenic. 
Strain name B6-Tg(Umod-Il1f6) 
Internal Code Umod-Il1f6 
Submitter Inaba Mutsumi 
Submitter affiliation or code Graduate School of Veterinary Medicine, Hokkaido University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Hokkaido University 
Organization code  
Developer Osamu Ichii 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Il1f6 
Gene name interleukin 1,family member 6 
Allele symbol Tg(Umod-Il1f6) 
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer ATGAGCTGCCTGTTCTGCAC 
TATTAGGACAAGGCTGGTGGGCAC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown