Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
242 
Type of strain Targeted mutant. 
Strain name 129-Atp6v0ctm1 
Internal Code PL16+/- (Atp6l+/-) mouse
PL16+/- mouse (Atp6l+/- mouse) 
Submitter Hiroki Inoue 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Osaka univ. 
Organization code  
Developer Hiroki Inoue 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Atp6v0c 
Gene name ATPase, H+ transporting, V0 subunit C 
Allele symbol Atp6v0ctm1 
Allele name Atp6v0c, targeted mutation 1 
MGI MGI:88116 
Chromosome 17  
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
GO
GO ID GO Term GO Evidence Code
GO:0033179 proton-transporting V-type ATPase, V0 domain IEA
GO:0045263 proton-transporting ATP synthase complex, coupling factor F(o) IEA
GO:0015986 ATP synthesis coupled proton transport IEA
GO:0033177 proton-transporting two-sector ATPase complex, proton-transporting domain IEA
GO:0006810 transport IEA
GO:0015992 proton transport IEA
GO:0005773 vacuole IEA
GO:0006811 ion transport IEA
GO:0016020 membrane IEA
GO:0016021 integral to membrane IEA
more... (Total Hit Count: 16)
OMIM OMIM ID: 108745
Human Gene Symbol: ATP6V0C

GO
GO ID GO Term GO Evidence Code
GO:0033179 proton-transporting V-type ATPase, V0 domain IEA
GO:0045263 proton-transporting ATP synthase complex, coupling factor F(o) IEA
GO:0015986 ATP synthesis coupled proton transport IEA
GO:0033177 proton-transporting two-sector ATPase complex, proton-transporting domain IEA
GO:0006810 transport IEA
GO:0015992 proton transport IEA
GO:0005773 vacuole IEA
GO:0006811 ion transport IEA
GO:0016020 membrane IEA
GO:0016021 integral to membrane IEA
more... (Total Hit Count: 16)
 
 Primer 1
  PCR Primer primerA  5'(TTGCCTCCTCGCTCGCTGTCCCGTT)3' 
primerB  3'(CTGACCCGTGTTGTCTGTTAGCCGA)5' 
 

 Reference information
 reference information 1
  Author
Hiroki Inoue, Takato Noumi, Mitsuo Nagata, Hiroshi Murakami, Hiroshi Kanazawa 
Title Targeted disruption of the gene encoding the proteolipid subunit of mouse vacuolar H+-ATPase leads to early embryonic lethality 
Journal BIOCHIMICA ET BIOPHYSICA ACTA 
Volume 1413 
Page 130-138 
Year 1999 
PMID 10556625  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 108745
Human Gene Symbol: ATP6V0C