Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1153 
Type of strain Targeted mutant. 
Strain name STOCK Calrtm1.1Osb 
Internal Code calr-tm1 
Submitter Masaru Okabe 
Submitter affiliation or code Genome Information Research (enter Osaka University) 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa) 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Research Institute for Microbial Diseases, Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Calr 
Gene name calreticulin 
Allele symbol Calrtm1.1Osb 
Allele name calreticulin, targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:88252 
Chromosome 8 (41.21) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer 2621  gagtggaaaccaggtgaaattgacaacc 
2622  cttctctgataagttttcctctgacctc 
 

 Reference information
 reference information 1
  Author
Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4. 
Title Calreticulin is required for development of the cumulus oocyte complex and female fertility. 
Journal Sci Rep. 
Volume
Page 14254 
Year 2015 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Immunology, Development, Physiology