Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name STOCK Canxtm1Osb 
Internal Code Canx-tm2 
Submitter Masaru Okabe 
Submitter affiliation or code Genome Information Research (enter Osaka University) 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. (Contact to Masahito Ikawa) 
Production method In-house breading.
Organization Research Institute for Microbial Diseases, Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name calnexin 
Allele symbol Canxtm1.1Osb 
Allele name calnexin; targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:88261 
Chromosome 11 (30.46) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
  PCR Primer 1072  gctctggatgccttgggatttgatttc 
1074  ggatttagtggatatccccagtatgagc 

 Reference information
 reference information 1
Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4. 
Title Calreticulin is required for development of the cumulus oocyte complex and female fertility. 
Journal Sci Rep. 
Page 14254 
Year 2015 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology, Immunology, Development, Physiology