Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1150 
Type of strain Targeted mutant. 
Strain name B6;129S2-Pmis2tm1Osb 
Internal Code Spots3-KO 
Submitter Masaru Okabe 
Submitter affiliation or code Genome Information Research (enter Osaka University) 
Stock Type  
Material Transfer Conditions Other conditions. 
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa) 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Research Institute for Microbial Diseases,Osaka University 
Organization code Osb 
Developer Ryo Yamaguchi 
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Pmis2 
Gene name Pmis2, sperm specific protein  
Allele symbol Pmis2tm1Osb 
Allele name Pmis2, sperm specific protein; targeted mutation 1, Masaru Okabe 
MGI MGI:1922177 
Chromosome 7 (19.08) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Primer A  GGAATTCGACACCAGGATCTGTCATTG 
Primer B  AGAATTCTGAAAGAGCAGCTCAGTGGC 
Primer C  AGGGGAGGAGTAGAAGGTGGCGCGAAGGGG 
Primer D  AGGATGGATTTCACAGGGCTAAGG 
 

 Reference information
 reference information 1
  Author
Yamaguchi R, Fujihara Y, Ikawa M, Okabe M. 
Title Mice expressing aberrant sperm-specific protein PMIS2 produce normal-looking but fertilization-incompetent spermatozoa 
Journal Mol Biol Cell. 
Volume 23(14) 
Page 2671-9 
Year 2012 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development