Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
240 
Type of strain Transgenic. 
Strain name BXD-Tg(Hpoc-OSF1) 
Internal Code Bone-rich mouse
HPoc-Hosf1-6 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kyoto Pref. Univ, Med., RINDG, DBMG 
Organization code  
Developer Harufumi Masuda & T.Hashimoto-Gotoh 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
OSF1(=PTN) 
Gene name Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1)(Human) 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method  
OMIM OMIM ID: 162095
Human Gene Symbol: PTN

 
 Primer 1
  PCR Primer primerA  5'(GAAAATTTGCAGCTGCCTTC)3' OSF_U246 
primerB  3'(AACTCGTAGACTGAAGACC)5' TGL542 
 

 Reference information
 reference information 1
  Author
Haruchika Masuda, Atsushi Tasujimura, Makoto Yoshioka, Yuji Arai, Yoshinori Kuboki, Tsunehiro Mukai, Toshitaka Nakamura, Hajime Tsuji, Masao Nakagawa, and Tamotsu Hashimoto-Gotoh 
Title Bone Mass Loss Due to Estrogen Deficiency Is Compensated in Transgenic Mice Overexpressing Human Osteoblast Stimulating Factor-11 
Journal BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS 
Volume 238 
Page 528-533 
Year 1997 
PMID 9299545  
 
 reference information 2
  Author
Hashimoto-Gotoh, T., Masuda, H., Yamaguchi, M., Tsujimura, A., Ohnishi, H., Imai, S., Inoue, K., Nakamura, T., Hirasawa, T. and Nakagawa, M. 
Title Feasibility of gene therapy using human OSF1 against osteoporosis 
Journal Osteoporosis Japan 
Volume
Page 5-7 
Year 2001 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism 
  OMIM OMIM ID: 162095
Human Gene Symbol: PTN