Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1147 
Type of strain Targeted mutant. 
Strain name STOCK Calr3tm1Osb 
Internal Code calr3-tm1 
Submitter Masaru Okabe 
Submitter affiliation or code Genome Information Research (enter Osaka University) 
Stock Type  
Material Transfer Conditions Other conditions. 
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa) 
Production method In-house breading.
 
Origin
(In-house)
Organization Research Institute for Microbial Diseases,Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Calr3 
Gene name calreticulin3 
Allele symbol Calr3tm1Osb 
Allele name calreticulin3, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University 
MGI MGI:1920566 
Chromosome 8 (35.08) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer 1172  GTCTGTTAGTAGTGTGCATG 
1177  TTCTGGTCCAGGTCAGACGG 
114  ATCT ggACgA AgAgCA TCAg 
 

 Reference information
 reference information 1
  Author
Ikawa M, Tokuhiro K, Yamaguchi R, Benham AM, Tamura T, Wada I, Satouh Y, Inoue N, Okabe M. 
Title Calsperin is a testis-specific chaperone required for sperm fertility 
Journal J Biol Chem 
Volume 286(7) 
Page 5639-46 
Year 2011 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Development