Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2342 
Type of strain Targeted mutant. 
Strain name STOCK-Rag2tm1,Jak3tm1,Mcm3aptm1Imku 
Internal Code
Submitter Kuwahara Kazuhiko 
Submitter affiliation or code Aichi Cancer Center Research Institute 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Aichi Cancer Center Research Institute 
Organization code  
Developer Kazuhiko Kuwahara 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Rag2 
Gene name recombination activating gene 2 
Allele symbol Rag2tm1 
Allele name recombination activating gene 2, targeted mutation 1, 
MGI MGI:97849 
Chromosome 2 (53.87) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Gene information 2
  Gene symbol
Jak3 
Gene name Janus kinase 3 
Allele symbol Jak3tm1 
Allele name Janus kinase 3, targeted mutation 1, 
MGI MGI:99928 
Chromosome 8 (34.43) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Gene information 3
  Gene symbol
Mcm3ap 
Gene name minichromosome maintenance complex component 3 associated protein 
Allele symbol Mcm3aptm1Ikmu 
Allele name minichromosome maintenance complex component 3 associated protein, targeted mutation 1,Department of Immunology, Kumamoto University Medical School 
MGI MGI:1930089 
Chromosome 10 (38.88) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Neo 5'-int  GCAGCTGTGCTCGACGTTGT 
Neo 3'-int  GGCGATACCGTAAAGCACGA 
 

 Disease , Applicable field information
  Disease name,
Applicable field
cancer, Development