Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2332 
Type of strain Transgenic. 
Strain name STOCK-Tg(CAG-mcm3ap)Imku 
Internal Code GANP (CAG) Tg 
Submitter Kuwahara Kazuhiko 
Submitter affiliation or code Aichi Cancer Center Research Institute 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
mcm3ap 
Gene name minichromosome maintenance complex component 3 associated protein 
Allele symbol Tg(CAG-mcm3ap)Imku 
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer mganp1-5'  TCCCGCCTTCCAGCTGTGAC 
mganp1-3'  GTGCTGCTGTGTTATGTCCT 
 

 Disease , Applicable field information
  Disease name,
Applicable field
cancer