Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2327 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(eR1(+24m)-mhsp68-CreERT2)5-2 
Internal Code eR1(+24m)CreERT2#5-2 
Submitter Osato Motomi 
Submitter affiliation or code International Research Center for Medical Sciences, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization International Research Center for Medical Sciences, Kumamoto University AND Cancer Science Institute of Singapore, National University of Singapore 
Organization code  
Developer Motomi Osato 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
CreERT2 
Gene name Cre recombinase T2 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer eR1(+24m)-325FP  CACTGATAACGTGGGCAGCTT 
mhsp68-175RP  GTGTCCGGTGACGTGATCCTC 
 

 Reference information
 reference information 1
  Author
Ng CE, Yokomizo T, Yamashita N, Cirovic B, Jin H, Wen Z, Ito Y, Osato M. 
Title A Runx1 intronic enhancer marks hemogenic endothelial cells and hematopoietic stem cells. 
Journal Stem Cells 
Volume 28(10) 
Page 1869-81 
Year 2010 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Digestive Disorders, Urology, cancer, Laboratory-animal Science, Development, Aging, Respiratory System