Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2321 
Type of strain Targeted mutant. 
Strain name B6-ROSA26Tm(SAWZ)21Card 
Internal Code R26SAWZ-21 
Submitter Araki Kimi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, Kumamoto University 
Organization code Card 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gt(ROSA)26Sor 
Gene name gene trap ROSA 26, Philippe Soriano 
Allele symbol  
Allele name  
MGI MGI:104735 
Chromosome 6  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer WZ-14  GCTCTCTACAGGTGGATCAAG 
WZ-17  GCAGTTCAATCAGCTGCTTTC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Others