Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2318 
Type of strain Targeted mutant. 
Strain name B6-ROSA26Tm(SAEiCE)16Card 
Internal Code R26SAEiCE,16 
Submitter Masatake ARAKI 
Submitter affiliation or code Gene Technology Center, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, Kumamoto University 
Organization code Card 
Developer Masatake Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gt(ROSA)26Sor 
Gene name gene trap ROSA 26, Philippe Soriano 
Allele symbol  
Allele name  
MGI MGI:104735 
Chromosome 6  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer iCre-1  AGGCCTTCTCTGAACACACC 
iCre-2  TTGGTCCTGCCAATGTGGATC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Others