Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2241 
Type of strain Transgenic. 
Strain name STOCK-Tg(CM-tslc1-IRES-hrGFP)b 
Internal Code TgN(CM-tslc1-IRES-hrGFP)-b 
Submitter Wakayama Tomohiko 
Submitter affiliation or code Kumamoto University 
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kumamoto University 
Organization code  
Developer Tomohiko Wakayama 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
tsk1 
Gene name tumor suppressor in lung cancer -1 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer hrGFP-F  TTCACCAAGTACCCCGAG 
hrGFP-R  CATGTGGCAGCTGTAGAACT 
 

 Reference information
 reference information 1
  Author
Fujihara Y, Okabe M, Ikawa M 
Title GPI-anchored protein complex, LY6K/TEX101, is required for sperm migration into the oviduct and male fertility in mice. 
Journal Biol Reprod 
Volume 90(3) 
Page 60 
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development, Anatomy