Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2214 
Type of strain Targeted mutant. 
Strain name STOCK-Svs2tm2Kemi 
Internal Code SVS2KO KOMP 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Joint research 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer KOMP 
Year introduced  
Introduced 
Generation
F0 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Svs2 
Gene name Svs2 
Allele symbol Svs2tm2Kemi 
Allele name seminal vesicle secretory protein 2; targeted mutation 2, Kenji Miyado 
MGI MGI:1858275 
Chromosome 2 (84.82) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0005515 protein binding IPI
GO:0008285 negative regulation of cell proliferation IDA
GO:0007155 cell adhesion IEA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0030913 paranodal junction assembly IDA
GO:0007342 fusion of sperm to egg plasma membrane IDA
GO:0007338 single fertilization IEA
GO:0005886 plasma membrane TAS
OMIM OMIM ID: 143030
Human Gene Symbol: CD9

GO
GO ID GO Term GO Evidence Code
GO:0005515 protein binding IPI
GO:0008285 negative regulation of cell proliferation IDA
GO:0007155 cell adhesion IEA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0030913 paranodal junction assembly IDA
GO:0007342 fusion of sperm to egg plasma membrane IDA
GO:0007338 single fertilization IEA
GO:0005886 plasma membrane TAS
 
 Primer 1
  PCR Primer Neo-F  AGAGGCTATTCGGCTATGAC 
Neo-R  CACCATGATATTCGGCAAGC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 143030
Human Gene Symbol: CD9