Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name STOCK-Svs2tm1Osb 
Internal Code SVS2KO handai 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Joint research 
Production method From other organizations.
Organization code  
(From other organizations)
Organization Institute for microbial diseases, Osaka University 
Organization code  
Developer Masaru Okabe 
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name seminal vesicle secretory protein 2 
Allele symbol Svs2tm1Osb 
Allele name seminal vesicle secretory protein 2, targeted mutation 1 
MGI MGI:1858275 
Chromosome 2 (84.82) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO ID GO Term GO Evidence Code
GO:0007338 single fertilization IEA
GO:0005515 protein binding IPI
GO:0008285 negative regulation of cell proliferation IDA
GO:0007155 cell adhesion IEA
GO:0007342 fusion of sperm to egg plasma membrane IDA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0030913 paranodal junction assembly IDA
GO:0005886 plasma membrane TAS
OMIM OMIM ID: 143030
Human Gene Symbol: CD9

GO ID GO Term GO Evidence Code
GO:0007338 single fertilization IEA
GO:0005515 protein binding IPI
GO:0008285 negative regulation of cell proliferation IDA
GO:0007155 cell adhesion IEA
GO:0007342 fusion of sperm to egg plasma membrane IDA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0030913 paranodal junction assembly IDA
GO:0005886 plasma membrane TAS
 Primer 1
  PCR Primer 2516  5'(caaacdtggggactaagcat)3' 
Neo  5'(atctggacgaagagcatcag)3' 

 Reference information
 reference information 1
Natsuko Kawano, Naoya Araki, Kaoru Yoshida, Taku Hibino, Naoko Ohnami, Maako Makino, Seiya Kanai, Hidetoshi Hasuwa, Manabu Yoshida, Kenji Miyado, Akihiro Umezawa 
Title Seminal vesicle protein SVS2 is required for sperm survival in the uterus 
Journal Proceedings of the National Academy of Sciences 
Volume 111 
Page 4145-4150 
Year 2014 
 Disease , Applicable field information
  Disease name,
Applicable field
  OMIM OMIM ID: 143030
Human Gene Symbol: CD9