Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2211 
Type of strain Targeted mutant.
Transgenic. 
Strain name STOCK-Cd9tm1Tg(Svs2)Kemi 
Internal Code SVS2KO BACTG 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Joint research 
Production method In-house breading.
 
Origin
(In-house)
Organization National Research Institute for Child Health and Development 
Organization code  
Developer Kenji Miyado 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Svs2 
Gene name seminal vesicle secretory protein 2 
Allele symbol  
Allele name  
MGI MGI:1858275 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Gene information 2
  Gene symbol
Cd9 
Gene name CD9 antigen 
Allele symbol  
Allele name  
MGI MGI:88348 
Chromosome 2 (84.82) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0030913 paranodal junction assembly IDA
GO:0005886 plasma membrane TAS
GO:0016021 integral to membrane IEA
GO:0008285 negative regulation of cell proliferation IDA
GO:0007342 fusion of sperm to egg plasma membrane IDA
GO:0007155 cell adhesion IEA
GO:0005515 protein binding IPI
GO:0016020 membrane IEA
GO:0007338 single fertilization IEA
OMIM OMIM ID: 143030
Human Gene Symbol: CD9

GO
GO ID GO Term GO Evidence Code
GO:0030913 paranodal junction assembly IDA
GO:0005886 plasma membrane TAS
GO:0016021 integral to membrane IEA
GO:0008285 negative regulation of cell proliferation IDA
GO:0007342 fusion of sperm to egg plasma membrane IDA
GO:0007155 cell adhesion IEA
GO:0005515 protein binding IPI
GO:0016020 membrane IEA
GO:0007338 single fertilization IEA
 
 Primer 1
  PCR Primer SalI_F1  atgtcaccaggggcagtaag 
NotI_R1  gtggacccaggacttcttca 
 

 Reference information
 reference information 1
  Author
Natsuko Kawano, Naoya Araki, Kaoru Yoshida, Taku Hibino, Naoko Ohnami, Maako Makino, Seiya Kanai, Hidetoshi Hasuwa, Manabu Yoshida, Kenji Miyado, Akihiro Umezawa 
Title Seminal vesicle protein SVS2 is required for sperm survival in the uterus 
Journal Proceedings of the National Academy of Sciences 
Volume 111 
Page 4145-4150 
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 143030
Human Gene Symbol: CD9