Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2204 
Type of strain Targeted mutant.
Transgenic. 
Strain name B6;129-Deddtm1TimyTg(Cdh5-Dedd)6Timy 
Internal Code DEDD KO/ DEDD TG 
Submitter Miyazaki Toru 
Submitter affiliation or code Lab of Molecular Biomedicine for Pathogenesis, Center for Disease Biology and Integrative Medicine (CDBIM), The University of Tokyo 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Dedd 
Gene name Death effector domain-containing (with C-terminal HA-tag) 
Allele symbol Tg(Cdh5-Dedd) 
Allele name transgene insertion 
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Gene information 2
  Gene symbol
Dedd 
Gene name death effector domain-containing 
Allele symbol Deddtm1Timy 
Allele name death effector domain-containing, targeted mutation 1, Toru Miyazaki 
MGI MGI:1333874 
Chromosome 1 (79.34) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer beta-globin 5  tgctggttattgtgctgtctcatc 
Dedd215-191  tccagtgccaataagaagtcacgtc 
 
 Primer 2
  PCR Primer TM-1  cagccagatttacatagtgaaatc 
NY-5  ccgctatcaggacatagcgttggc 
 
 Primer 3
  PCR Primer DEDD Exon2  gcactctatttctgagcctctagc 
DEDD Intron2-3  atctttcttctcccaaaggatctc 
 

 Reference information
 reference information 1
  Author
Mori M, Kitazume M, Ose R, Kurokawa J, Koga K, Osuga Y, Arai S, Miyazaki T 
Title Death effector domain-containing protein (DEDD) is required for uterine decidualization during early pregnancy in mice. 
Journal J Clin Invest 
Volume 121 
Page 318-27 
Year 2011 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction