Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2186 
Type of strain Targeted mutant. 
Strain name C57BL/6-Fezf1tm1 
Internal Code Fezf1 Knock out Mouse 
Submitter Tamamaki Nobuaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions Other conditions. 
If you use Fezf1 knockout mouse, please contact Dr. Tsutomu Hirata for MTA. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer Dr. Tsutomu Hirata 
Year introduced March 2014  
Introduced 
Generation
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fezf1 
Gene name Fez family zinc finger 1 
Allele symbol Fezf1tm1 
Allele name Fez family zinc finger 1, targeted mutation 1 
MGI MGI:1920441 
Chromosome 6 (10.55) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Fezf1 KO F  CAGCAGCCTCTGTTCCACATACACTTCAT 
Fezf1-R  CTTGATTCAGGGAATGAGCACCACCTCC 
 

 Reference information
 reference information 1
  Author
Hirata T, Nakazawa M, Muraoka O, Nakayama R, Suda Y, Hibi M. 
Title Zinc-finger genes Fez and Fez-like function in the establishment of diencephalon subdivisions. 
Journal Development 
Volume Oct;133(20) 
Page 3993-4004 
Year 2006 
PMID  
 
 reference information 2
  Author
Hirata-Fukae C, Hirata T. 
Title The zinc finger gene Fezf2 is required for the development of excitatory neurons in the basolateral complex of the amygdala. 
Journal Dev Dyn. 
Volume Aug;243(8) 
Page 1030-6. 
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Neurobiology, Cell biology, Laboratory-animal Science, Development, Molecular biology