Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2165 
Type of strain Targeted mutant. 
Strain name STOCK Lypd4tm1Osb/6A 
Internal Code Lypd4 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Lypd4 
Gene name Ly6/Plaur domain containing 4 
Allele symbol Lypd4tm1Osb 
Allele name Ly6/Plaur domain containing 4, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:2687054 
Chromosome 7 (13.30) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer #719  GCCTTCTATCGCCTTCTTGACGAGTTCTTC 
#6156  CTAGGGATTACTGGCAAGAACGGGG 
 
 Primer 2
  PCR Primer #6157  GGGTTGACTGGCCTTGAGTCTCAC 
 

 Reference information
 reference information 1
  Author
Yoshitaka Fujihara, Taichi Noda, Kiyonori Kobayashi, Asami Oji, Sumire Kobayashi, Takafumi Matsumura, Tamara Larasati, Seiya Oura, Kanako Kojima-Kita, Zhifeng Yu, Martin M. Matzuk, and Masahito Ikawa 
Title Identification of multiple male reproductive tract-specific proteins that regulate sperm migration through the oviduct in mice 
Journal Proc Natl Acad Sci U S A.  
Volume 116(37) 
Page 18498-18506 
Year 2019 
PMID