Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2158 
Type of strain Targeted mutant. 
Strain name STOCK-Pmis2tm1Osb 
Internal Code Pmis2 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Pmis2 
Gene name Pmis2, sperm specific protein 
Allele symbol Pmis2tm1Osb 
Allele name Pmis2, sperm specific protein; targeted mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:1922177 
Chromosome 7 (19.08) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer 1133  GGAATTCGACACCAGGATCTGTCATTG 
1135  AGAATTCTGAAAGAGCAGCTCAGTGGC 
 
 Primer 2
  PCR Primer 298  AGGGGAGGAGTAGAAGGTGGCGCGAAGGGG 
1158  AGGATGGATTTCACAGGGCTAAGG 
 

 Reference information
 reference information 1
  Author
Yamaguchi R, Fujihara Y, Ikawa M, Okabe M. 
Title Mice expressing aberrant sperm-specific protein PMIS2 produce normal-looking but fertilization-incompetent spermatozoa 
Journal Mol Biol Cell. 
Volume 23(14) 
Page 2671-9 
Year 2012 
PMID