Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2155 
Type of strain Targeted mutant. 
Strain name C57BL/6-Pate4tm1(KOMP)Osb3A 
Internal Code Pate4 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Pate4 
Gene name prostate and testis expressed 4  
Allele symbol Pate4tm1(KOMP)Osb3A 
Allele name prostate and testis expressed 4, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:1930790 
Chromosome 9 (20.34) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer #5319  ATCCGGGGGTACCGCGTCGAG 
#5897  GGTAAGTGGGGCTGATACAGACTCC 
 
 Primer 2
  PCR Primer #5898  CCTTGCACTGAGGCGAGCAC 
 

 Reference information
 reference information 1
  Author
Noda T, Fujihara Y, Matsumura T, Oura S, Kobayashi S, Ikawa M. 
Title Seminal vesicle secretory protein 7, PATE4, is not required for sperm function but for copulatory plug formation to ensure fecundity. 
Journal Biol Reprod. 
Volume 100(4) 
Page 1035-1045 
Year 2019 Apr 19 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development